Extraction of high-quality tissue-specific RNA from London plane trees (Platanus acerifolia), permitting the construction of a female inflorescence cDNA library

Extraction of high-quality tissue-specific RNA from London plane trees (Platanus acerifolia), permitting the construction of a female inflorescence cDNA library

The London airplane tree (Platanus acerifolia Willd.) has world significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.

An in depth RNA isolation and purification protocol, based mostly on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with further purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was performed. In brief, phenolic compounds are certain to soluble polyvinylpyrrolidone after which separated out via LiCl precipitation of the RNA. Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation.

The ensuing isolates of RNA have been discovered to be of enough high quality for profitable use in reverse transcription PCR evaluation. Moreover, RNA isolates from feminine inflorescences have been used for the development of a cDNA library. This library was discovered to comprise a number of full-length cDNA clones of MADS-box genes, according to the library being consultant of inflorescence expression profiles.

Molecular evaluation of a stress-induced cDNA encoding the interpretation initiation issue, eIF1, from the salt-tolerant wild relative of rice, Porteresia coarctata

The evaluation of plant response to emphasize is a crucial path to the invention of genes conferring stress tolerance. Protein synthesis may be very delicate to salt stress and proteins concerned on this course of could also be an necessary determinant of salt tolerance. The halophytic plant, Porteresia coarctata Tateoka, is an in depth relative of Oryza sativa L., and has the power to face up to sudden adjustments within the soil salinity.

The interpretation initiation issue 1 (PceIF1) cDNA was remoted from the leaves of P. coarctata that had been subjected to a high-salt remedy (150 mm NaCl). An expression research confirmed that the abundance of eIF1 transcripts elevated to a most degree 5 d after stress induction after which decreased to ranges much like leaves of management (unsalinised) crops.

This gene was additionally up-regulated in exogenous abscisic acid (ABA) and mannitol remedies, suggesting that its induction is expounded to the water deficit impact of excessive salt. Our research confirmed that expression ranges of eIF1 transcripts may kind a handy indicator for monitoring a stress-responsive mechanism that operates within the leaves of P. coarctata.

Transcriptome evaluation of leaf tissue from Bermudagrass (Cynodon dactylon) utilizing a normalised cDNA library

A normalised cDNA library was constructed from Bermudagrass to achieve perception into the transcriptome of Cynodon dactylon L. A complete of 15 588 high-quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Analysis Gene Indices clustering instruments to supply a unigene set. A complete of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation process was efficient.

A big-scale comparative genomic evaluation of the unigenes was carried out utilizing publicly out there instruments, resembling BLAST, InterProScan and Gene Ontology. The unigenes have been additionally subjected to a seek for EST-derived easy sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), that are helpful as DNA markers.

Extraction of high-quality tissue-specific RNA from London plane trees (Platanus acerifolia), permitting the construction of a female inflorescence cDNA library

Though the candidate EST-SSRs and CISPs discovered within the current research have to be empirically examined, they’re anticipated to be helpful as DNA markers for a lot of functions, together with comparative genomic research of grass species, by advantage of their vital similarities to EST sequences from different grasses. Thus, information of Cynodon ESTs will empower turfgrass analysis by offering homologues for genes which can be thought to confer necessary capabilities in different crops.

Lengthy-read cDNA Sequencing Permits a ‘Gene-Like’ Transcript Annotation of Transposable Parts

Transcript-based annotations of genes facilitate each genome-wide analyses and detailed single locus analysis. In distinction, transposable factor (TE) annotations are rudimentary, consisting of knowledge solely on TE location and sort. The repetitiveness and restricted annotation of TEs prevents the power to differentiate between probably practical expressed parts and degraded copies.

To enhance genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana traces poor in a number of layers of TE repression. These uniquely-mapping transcripts have been used to determine the set of TEs in a position to generate polyadenylated RNAs and create a brand new transcript-based annotation of TEs that we’ve layered upon the prevailing high-quality group commonplace annotation.

cDNA from Human Adult Normal Tissue: Uterus: Cervix

C1234275 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Corpus

C1234276-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Fundus

C1234278-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix

C1534275 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus: Cervix

C1534275-Cy 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus

C1534276 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus

C1534278 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-48T 48T
EUR 441
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-96T 96T
EUR 570
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-48T 48T
EUR 527
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-96T 96T
EUR 688
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-48T 48T
EUR 549
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-96T 96T
EUR 718
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-48Tests 48 Tests
EUR 436

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-96Tests 96 Tests
EUR 601

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-48Tests 48 Tests
EUR 533

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-96Tests 96 Tests
EUR 740

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-48Tests 48 Tests
EUR 557

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-96Tests 96 Tests
EUR 775

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-48Tests 48 Tests
EUR 455

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-96Tests 96 Tests
EUR 629

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-48Tests 48 Tests
EUR 557

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-96Tests 96 Tests
EUR 774

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-48Tests 48 Tests
EUR 583

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-96Tests 96 Tests
EUR 811

Human Uterus Tumor lysate

HTL-1384 1 mg
EUR 773

Total RNA from Human Adult Normal Tissue: Uterus: Cervix of uterus

R1234275-50 50 ug
EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Human Adult Normal Tissue: Uterus: Corpus of Uterus

R1234276-10 10 ug
EUR 194
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Lupus: Uterus

R1236274Lup-50 50 ug
EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT/ Rat CAT ELISA Kit

ELA-E0242r 96 Tests
EUR 886

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Uterus: Cervix of uterus

R1234275-P 50 ug
EUR 328
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT siRNA

20-abx900807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT Antibody

36312-100ul 100ul
EUR 252

Cat IgM

31C-CH0213 1 mg
EUR 392
Description: Purified Cat IgM

CAT antibody

10R-3584 100 ul
EUR 726
Description: Mouse monoclonal CAT antibody

CAT antibody

10R-3585 100 ul
EUR 691
Description: Mouse monoclonal CAT antibody

CAT antibody

20C-CR1111RP 500 ul
EUR 262
Description: Rabbit polyclonal CAT antibody

CAT antibody

70R-16187 50 ul
EUR 435
Description: Rabbit polyclonal CAT antibody

CAT Antibody

1-CSB-PA942303
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA004563GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody

1-CSB-PA004980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT Antibody

1-CSB-PA599838
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA070043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

pOTB7-CAT

PVT18217 2 ug
EUR 231

pCas9- CAT

PVT11001 2 ug
EUR 301

Frozen Tissue Section - Human Tumor: Uterus

T1235274 5 slides
EUR 338
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Adult Uterus (Normal) Whole tissue lysate

HAL-1317 1 mg
EUR 524

FFPE Genomic DNA - Human Tumor Tissue: Uterus

D2235274 2 ug
EUR 821
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Monkey (Rhesus) Normal Uterus Whole tissue lysate

MRL-1332 1 mg
EUR 773

Total Protein from Human Tumor Tissue: Uterus

P1235274 1 mg
EUR 320
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Monkey (Cyno.) Normal Uterus Whole tissue lysate

MCL-1222 1 mg
EUR 773

Membrane Protein from Human Tumor Tissue: Uterus

P3235274 0.1 mg
EUR 408
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total RNA from Human Tumor Tissue: Uterus

R1235274-50 50 ug
EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Frozen Tissue Section - Human Adult Normal: Uterus

T1234274 5 slides
EUR 349
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Human Adult Normal: Uterus

T2234274 5 slides
EUR 211
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Human Uterus Cervix Tumor

T2235275 5 slides
EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

PKA CAT Antibody

AF5450 200ul
EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.

CAT Conjugated Antibody

C36312 100ul
EUR 397

PKA CAT Antibody

AF7746 200ul
EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.

CAT cloning plasmid

CSB-CL004563HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG
  • Show more
Description: A cloning plasmid for the CAT gene.

Cat Uromodulin Enzyme

20-abx073947
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125619
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125620
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx111432
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx132110
  • EUR 272.00
  • EUR 592.00
  • EUR 314.00
  • EUR 154.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx132122
  • EUR 300.00
  • EUR 718.00
  • EUR 384.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx141181
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

PKA CAT Antibody

abx147539-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx148940
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx100146
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100147
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100148
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100149
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100150
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100151
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

abx034033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx034033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx025488-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx004037
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

PKA CAT Antibody

ABF5450 100 ug
EUR 438

Catalase (CAT) Antibody

20-abx175722
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Catalase (CAT) Antibody

20-abx323535
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx326479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx214177
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx430824-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Catalase (CAT) Antibody

20-abx242079
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx231301-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx171619
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

CAT Rabbit pAb

A11777-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11777-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11777-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11777-50ul 50 ul
EUR 223

CAT Rabbit pAb

A11780-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11780-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11780-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11780-50ul 50 ul
EUR 223

Normal Cat Serum

88R-1026 10 ml
EUR 250
Description: Normal Cat Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

CAT Rabbit pAb

A5275-100ul 100 ul
EUR 308

CAT Rabbit pAb

A5275-200ul 200 ul
EUR 459

CAT Rabbit pAb

A5275-20ul 20 ul Ask for price

CAT Rabbit pAb

A5275-50ul 50 ul Ask for price

b-cat antibody

70R-21460 50 ul
EUR 435
Description: Rabbit polyclonal b-cat antibody

Feline Cat IgG

31-1005 5 mg
EUR 175
Description: Feline (Cat) IgG Purified-Protein A

Cat RBC antibody

20R-RR015 20 mg
EUR 327
Description: Rabbit polyclonal Cat RBC antibody

Cat RBC antibody

20R-RR016 5 mg
EUR 554
Description: Rabbit polyclonal Cat RBC antibody

Cat IgG (FITC)

65C-CH0202 1 mg
EUR 227
Description: Purified Cat IgG FITC conjugate

Cat IgG (HRP)

65C-CH0203 1 mg
EUR 248
Description: Purified Cat IgG HRP conjugate

Recombinant Human CAT

P0501 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P04040
Description: Recombinant Human protein for CAT

Recombinant Catalase (CAT)

4-RPC418Hu01
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu02
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu03
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu04
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Mu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Rat Catalase (CAT)

QY-E11654 96T
EUR 374

pCEP4- CAT Plasmid

PVT1038 2 ug
EUR 266

pCMV-SPORT6-CAT

PVT14338 2 ug
EUR 495

Anti-CAT antibody

STJ27228 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ113361 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ113364 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ119991 100 µl
EUR 413
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Catalase (10,000-15,000 U/mg), Bovine Liver

CAT-01 25 mU
EUR 529

Catalase (2000-4000 U/mg), Aspergillus Niger

CAT-02 25 mU
EUR 651

Catalase (4000-6000 U/mg), Bovine Liver

CAT-03 5 mU
EUR 347

Catalase (>40,000 u/mg), Bovine Liver

CAT-04 1 mg
EUR 286

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

Human Uterus Tissue Slide (Normal) (5 slides/pk)

HTS-11401 1 pk
EUR 286

Human Uterus Tissue Slide (Benign) (5 slides/pk)

HTS-11402 1 pk
EUR 286

Human Uterus Tissue Slide (Adenocarcinoma) (5 slides/pk)

HTS-11404 1 pk
EUR 286

Human Uterus Tissue Slide (Abnormal) (5 slides/pk)

HTS-11419 1 pk
EUR 286

Human Uterus Tissue Slide (Adenomyoma) (5 slides/pk)

HTS-11432 1 pk
EUR 286

Total Protein from Human Adult Normal Tissue: Uterus

P1234274 1 mg
EUR 214
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Membrane Protein from Human Adult Normal Tissue: Uterus

P3234274 0.1 mg
EUR 285
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total RNA from Human Adult Normal Tissue: Uterus

R1234274-50 50 ug
EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Paraffin Tissue Section - Human Uterus Tumor: Endometrium Adenocarcinoma

T2235274-3 5 slides
EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

PKA CAT Blocking Peptide

AF5450-BP 1mg
EUR 195

We used this annotation to scale back the bioinformatic complexity related to multi-mapping reads from short-read RNA-seq experiments, and we present that this enchancment is expanded in a TE-rich genome resembling maize. Our TE annotation additionally permits the testing of particular standing hypotheses within the TE subject. We display that wrong TE splicing doesn’t set off small RNA manufacturing, and the cell extra strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work gives a brand new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to scale back the bioinformatic complexity related to repetitive TEs in any organism.

Leave a Reply

Your email address will not be published. Required fields are marked *